ABSTRACT
ABSTRACT Purpose: Stargardt-like phenotype has been described as associated with pathogenic variants besides the ABCA4 gene. This study aimed to describe four cases with retinal appearance of Stargardt disease phenotypes and unexpected molecular findings. Methods: This report reviewed medical records of four patients with macular dystrophy and clinical features of Stargardt disease. Ophthalmic examination, fundus imaging, and next-generation sequencing were performed to evaluate pathogenic variants related to the phenotypes. Results: Patients presented macular atrophy and pigmentary changes suggesting Stargardt disease. The phenotypes of the two patients were associated with autosomal dominant inheritance pattern genes (RIMS1 and CRX) and in the other two patients were associated with recessive dominant inheritance pattern genes (CRB1 and RDH12) with variants predicted to be pathogenic. Conclusion: Macular dystrophies may have phenotypic similarities to Stargardt-like phenotype associated with other genes besides the classic ones.
RESUMO Objetivo: Fenótipos Stargardt-like já foram asso-ciados a variantes patogênicas no gene ABCA4. O propósito desse estudo é descrever quatro pacientes com achados retinianos semelhantes a doença de Stargardt com resultados moleculares diferentes do esperado. Métodos: Esse relato fez a revisão de prontuários médicos de quatro pacientes com distrofia macular e achados clínicos sugestivos de doença de Stargardt. Foram realizados avaliação oftalmológica, exames de imagens e testes usando next generation sequencing para avaliar variantes patogênicas associadas aos fenótipos dos pacientes. Resultados: Os pacientes apresentavam atrofia macular e alterações pigmentares sugerindo achados clínicos de doença de Stargardt. Dois pacientes foram associados a genes com herança autossômica dominante (RIMS1 e CRX) e dois pacientes foram associados a genes com herança autossômica recessiva (CRB1 e RDH12) com variantes preditoras de serem patogênicas. Conclusão: Distrofias maculares podem ter similaridades fenotípicas com fenótipo de Stargardt-like associados a outros genes além dos classicamente já descritos.
ABSTRACT
SUMMARY OBJECTIVE: Charcot-Marie-Tooth disease covers a group of inherited peripheral neuropathies. The aim of this study was to investigate the effect of targeted next-generation sequencing panels on the molecular diagnosis of Charcot-Marie-Tooth disease and its subtypes in routine clinical practice, and also to show the limitations and importance of next-generation sequencing in the diagnosis of Charcot-Marie-Tooth diseases. METHODS: This is a retrospective study. Three different molecular methods (multiplex ligation probe amplification, next-generation sequencing, and whole-exome sequencing) were used to detect the mutations related to Charcot-Marie-Tooth disease. RESULTS: In total, 64 patients (33 males and 31 females) with suspected Charcot-Marie-Tooth disease were analyzed for molecular etiology. In all, 25 (39%) patients were diagnosed by multiplex ligation probe amplification. With an extra 11 patients with normal PMP22 multiplex ligation probe amplification results that were consulted to our laboratory for further genetic analysis, a total of 50 patients underwent next-generation sequencing for targeted gene panels associated with Charcot-Marie-Tooth disease. Notably, 18 (36%) patients had pathogenic/likely pathogenic variants. Whole-exome sequencing was performed on five patients with normal next-generation sequencing results; the diagnostic yield by whole-exome sequencing was 80% and it was higher in the childhood group. CONCLUSION: The molecular etiology in Charcot-Marie-Tooth disease patients can be determined according to pre-test evaluation, deciding the inheritance type with pedigree analysis, the clinical phenotype, and an algorithm for the genetic analysis. The presence of patients without a molecular diagnosis in all the literature suggests that there are new genes or mechanisms waiting to be discovered in the etiology of Charcot-Marie-Tooth disease.
ABSTRACT
ABSTRACT Clinical diagnosis of several neurodegenerative disorders based on clinical phenotype is challenging due to its heterogeneous nature and overlapping disease manifestations. Therefore, the identification of underlying genetic mechanisms is of paramount importance for better diagnosis and therapeutic regimens. With the emergence of next-generation sequencing, it becomes easier to identify all gene variants in the genome simultaneously, with a system-wide and unbiased approach. Presently various bioinformatics databases are maintained on discovered gene variants and phenotypic indications are available online. Since individuals are unique in their genome, evaluation based on their genetic makeup helps evolve the diagnosis, counselling, and treatment process at the personal level. This article aims to briefly summarize the utilization of next-generation sequencing in deciphering the genetic causes of Alzheimer's disease and address the limitations of whole genome and exome sequencing.
RESUMO O diagnóstico clínico de vários distúrbios neurodegenerativos com base no fenótipo clínico é difícil devido à sua natureza heterogênea e às manifestações da doença que se sobrepõem. Portanto, a identificação dos mecanismos genéticos subjacentes é de suma importância para um melhor diagnóstico e regimes terapêuticos. Com o surgimento do sequenciamento de próxima geração, o diagnóstico se tornou mais acessível com uma abordagem imparcial em todo o sistema para identificar simultaneamente todas as variantes de genes no genoma. Atualmente, vários bancos de dados de bioinformática sobre variantes genéticas descobertas e indicações fenotípicas estão disponíveis online. Uma vez que os indivíduos são únicos em seu genoma, a avaliação com base em sua composição genética ajudou na evolução do processo de diagnóstico, aconselhamento e tratamento em nível pessoal. Este artigo teve como objetivo resumir brevemente a utilização do sequenciamento de próxima geração para decifrar as causas genéticas da doença de Alzheimer (DA) e abordar as limitações do sequenciamento completo do genoma e do exoma.
Subject(s)
Computational Biology , Alzheimer Disease , ForecastingABSTRACT
Blood stream infection (BSI),a blood-borne disease caused by microorganisms such as bacteria,fungi,and viruses,can lead to bacteremia,sepsis,and infectious shock,posing a serious threat to human life and health.Identifying the pathogen is central to the precise treatment of BSI.Traditional blood culture is the gold standard for pathogen identification,while it has limitations in clinical practice due to the long time consumption,production of false negative results,etc.Nanopore sequencing,as a new generation of sequencing technology,can rapidly detect pathogens,drug resistance genes,and virulence genes for the optimization of clinical treatment.This paper reviews the current status of nanopore sequencing technology in the diagnosis of BSI.
Subject(s)
Humans , Nanopore Sequencing , Sepsis/diagnosis , Bacteremia/microbiology , Bacteria , Blood Culture/methodsABSTRACT
Objective:To investigate the effects of modified Buzhong Yiqi Decoction on intestinal microflora in a rat model of chronic obstructive pulmonary disease. Methods:From April to June 2021, 60 specific pathogen-free Wistar rats were selected for this study. They were randomly divided into blank control, model, traditional Chinese medicine, and western medicine groups with 15 rats per group. Rat models of chronic obstructive pulmonary disease with lung and spleen deficiency were established in all groups except the blank control group. Rat models in the traditional Chinese medicine and western medicine groups were administered modified Buzhong Yiqi Decoction and synbiotics. Rat models in the model and blank control groups were identically administered 0.9% sodium chloride injection. After 7 days, the feces of rats in each group were collected for 16S rRNA sequencing of intestinal flora. Effective sequences were clustered to obtain operational taxonomic units for principal coordinate analysis, species composition analysis, and alpha diversity analysis. The effects of modified Buzhong Yiqi Decoction on the structure, diversity, and abundance changes of intestinal flora were analyzed. Results:The dominant bacteria in the traditional Chinese medicine and western medicine groups were Firmicutes, while the dominant bacteria in the blank control and model groups were Bacteroides. The dominant bacterial groups in each group were mainly Lactobacillus and Bacteroides. Alpha diversity analysis showed that the Shannon index in the community diversity indices of traditional Chinese medicine, western medicine, and blank control groups was (3.65 ± 0.35), (3.65 ± 0.36), and (3.59 ± 0.20), respectively, which were significantly higher than (3.37 ± 0.26) in the model group ( t = 2.49, 2.44, 2.60, all P < 0.05). There was no significant difference in the Shannon index among traditional Chinese medicine, western medicine, and blank control groups (all P > 0.05). The Sobs index of the traditional Chinese medicine, western medicine, and blank control group was (458.67 ± 73.11), (454.80 ± 95.13), and (525.93 ± 101.88), respectively, which were significantly higher than (337.40 ± 37.49) in the model group ( t = 5.72, 4.45, 6.73, all P < 0.05). The Sobs index in the blank control group was higher than that in the western medicine group. There was no significant difference in the Sobs index between blank control and traditional Chinese medicine groups and between western medicine and traditional Chinese medicine groups (both P > 0.05). Principal coordinate analysis revealed that compared with the blank control group, Actinomycetes decreased and Proteobacteria and Desulfurization bacteria increased at the phylum level in the model group, while compared with the blank control group, Bacteroides, Rombutzia,Trichospirillus, and Parabacteroides increased, and Prevotella, Clostridium, Brucella, and Ruminococcus decreased at the genus level. Compared with the western medicine group, Bacillus, Prevotella, Brucella, and Prevotellidae in the traditional Chinese medicine group increased, while Clostridium, Pectinobacter, Christensen, and Trichospirillus decreased in the traditional Chinese medicine group. There was a statistically significant difference in the composition of the bacterial population between groups (all P < 0.05). Conclusion:There is an imbalance in intestinal microecology in a rat model of chronic obstructive pulmonary disease. Modified Buzhong Yiqi Decoction can regulate the intestinal microecology environment, improve the structure of intestinal flora, and increase the diversity and abundance of intestinal flora.
ABSTRACT
Objective:To investigate differences in bacterial and fungal microbiome between infected nails and healthy nails among patients with onychomycosis.Methods:Nail scraping samples were collected from infected nails and healthy nails of 31 patients with onychomycosis, who visited Dalian Dermatosis Hospital from August 2020 to July 2021. The total DNA of nail microbiota was extracted, and the V3-V4 regions of the bacterial 16S rDNA gene and the fungal internal transcribed spacer (ITS) region were amplified and sequenced using Illumina technology. The USEARCH and mothur softwares were used for data cluster analysis to obtain the operational taxonomic units (OTUs) , Wilcoxon rank sum test was used to analyze α diversity, analysis of similarities (ANOSIM) was performed to analyze β diversity, linear discriminant analysis of effect size (LEfSe) was performed to evaluate the species difference.Results:Among the 31 patients with onychomycosis, 16 were males and 15 were females. According to the age, they were divided into young group (18 - 35 years old, 10 cases) , middle-aged group (36 - 60 years old, 11 cases) , and elderly group (over 60 years old, 10 cases) . As the α-diversity analysis revealed, the infected nail group showed significantly decreased Shannon index ( W = 290, P = 0.007) , but significantly increased Simpson index ( W = 663, P = 0.010) compared with the healthy nail group, suggesting that the diversity and evenness of bacterial communities were lower in the infected nail group than in the healthy nail group; however, there was no significant difference in the diversity of fungal communities between the infected nail group and healthy nail group. The β-diversity analysis based on the unweighted-UniFrac distance matrix showed no significant difference in the fungal or bacterial community composition between the infected nail group and healthy nail group (bacterial communities: R = 0.0052, P = 0.331; fungal communities: R = 0.0036, P = 0.337) ; the β-diversity analysis based on the weighted-UniFrac distance matrix showed significant differences in the abundance of bacterial and fungal communities between the two groups (both P = 0.001) . In terms of the species composition, the bacterial flora with significantly decreased abundance in the infected nail group compared with the healthy nail group included Bacteroidetes, Proteobacteria, Betaproteobacteria, Burkholderiales, Ralstonia, Sphingomonas and Streptococcus, while the abundance of Bacilli, Bacillales and Staphylococcus was significantly higher in the infected nail group than in the healthy nail group. Compared with the healthy nail group, the fungal flora with significantly increased abundance in the infected nail group included Eurotiomycetes, Onygenales, Leotiomycetes-ord-incertae-sedis, Arthrodermataceae, Periconia, Erysiphe, Tilletiopsis, Trichophyton, Erysiphe cruciferarum, Trichophyton rubrum, Malassezia sympodialis, while the abundance of Saccharomycetes, Saccharomycetales, Saccharomycetaceae, Dothioraceae, Candida and Alternaria was significantly lower in the infected nail group than in the healthy nail group. Conclusion:The diversity and abundance of bacterial communities significantly differed between infected nails and healthy nails among patients with onychomycosis, while only the abundance of fungal communities differed between the two groups, and perhaps there was correlations between some bacterial and fungal communities.
ABSTRACT
@#Abstract: Objective To understand the characteristics of mutations associated with resistance among 72 multidrug-resistant tuberculosis (MDR-TB) strains using whole genome sequencing (WGS) and to evaluate the performance of WGS for predicting MDR-TB drug resistance. Methods The clinical strains isolated from patients who visited the outpatient department of Tianjin Center for Tuberculosis Control from January to September in 2020 were collected. Identification tests using p-nitrobenzoic acid (PNB) medium were performed. Drug susceptibility tests (proportion method) on L-J medium were performed. After excluding duplicate strains, 72 MDR-TB strains were selected for WGS. Data were analyzed by using online databases and the phenotypic drug susceptibility test results were compared with resistance profiles predicted by WGS. Results All of 72 MDR-TB strains belonged to linage 2, and there was no significant difference in rate of pre-extensive drug-resistant tuberculosis (pre-XDR-TB) between modern type and ancestral type (χ2=0.287, P=0.592). A total of 81 mutation types were found from resistance-related genes for 12 anti-tuberculosis drugs, and the common mutation types in different drug-resistant strains were: streptomycin (SM): rpsL Lys43Arg; isoniazid (INH): katG Ser315Thr; rifampicin (RIF): rpoB Ser450Leu; ethambutol (EMB): embB Met306Val; ofloxacin (OFX), levofloxacin (LFX), moxifloxacin (MFX): gyrA Asp94Gly; kanamycin (KAM), capreomycin (CAP), amikacin (AMK): rrs 1401a>g; para-aminosalicylic acid (PAS): folC Ile43Thr. Nine mutation types were found in 9 prothionamide (PTO)-resistant strains, one type for each strain. The sensitivity and specificity of WGS for predicting resistance to different drugs were SM: 98.15% and 88.89%, INH: 90.28% and -, RIF: 98.62% and -, EMB: 79.49% and75.76%, OFX: 97.30% and 85.71%, KAM: 85.71% and 98.46%, PAS: 27.27% and 95.08%, PTO: 81.82% and 60.66%, CAP: 60.00% and 98.51%, LFX: 97.22% and 83.33%, MFX: 97.30% and 85.71%, AMK:100.00% and 100.00%, respectively. Conclusion WGS is a rapid and promising method which has high consistency with the phenotypic drug sensitivity test. Therefore, it has good application prospects in predicting drug resistance in MDR-TB.
ABSTRACT
Primary central nervous system lymphoma (PCNSL) is a rare lymphoma type. The prognosis of PCNSL patients after treated by traditional therapy regimen is very poor. The way to evaluate the prognosis of PCNSL and to increase therapeutic efficacy have become the clinical problem. The 64th American Society of Hematology (ASH) annual meeting reported the latest research progress of diagnosis and treatment of PCNSL, including image examination, genetic sequencing, targeted therapy, chimeric antigen receptor T-cell (CAR-T) therapy and autologous hematopoietic stem cell transplantation (ASCT). This paper reviews the latest progress of PCNSL in the 64th ASH annual meeting.
ABSTRACT
Abstract This study aimed to analyze the molecular characteristics of oral epithelial dysplasia (OED), highlighting the pathways and variants of genes that are frequently mutated in oral squamous cell carcinoma (OSCC) and other cancers. Ten archival OED cases were retrieved for retrospective clinicopathological analysis and exome sequencing. Comparative genomic analysis was performed between high-grade dysplasia (HGD) and low-grade dysplasia (LGD), focusing on 57 well-known cancer genes, of which 10 were previously described as the most mutated in OSCC. HGD cases had significantly more variants; however, a similar mutational landscape to OSCC was observed in both groups. CASP8+FAT1/HRAS, TP53, and miscellaneous molecular signatures were also present. FAT1 is the gene that is most affected by pathogenic variants. Hierarchical divisive clustering showed division between the two groups: "HGD-like cluster" with 4HGD and 2LGD and "LGD-like cluster" with 4 LGD. MLL4 pathogenic variants were exclusively in the "LGD-like cluster". TP53 was affected in one case of HGD; however, its pathway was usually altered. We describe new insights into the genetic basis of epithelial malignant transformation by genomic analysis, highlighting those associated with FAT1 and TP53. Some LGDs presented a similar mutational landscape to HGD after cluster analysis. Perhaps molecular alterations have not yet been reflected in histomorphology. The relative risk of malignant transformation in this molecular subgroup should be addressed in future studies.
ABSTRACT
On September 15, 2020, a patient came in to Peking Union Medical College Hospital after suffering from chest pain, rash and lymphadenopathy for more than 2 years, and expericing general pain for 8 months. He also lost 15 kilograms of weight in the past half a year. For chest pain, cough, and expectoration symptons, cephalosporins and symptomatic treatments were empirically used and the symptoms were relieved. However, drug-induced rash occurred. After anti-allergic treatments, the rash was relieved but the swelling of cervical lymph nodes was not relieved. Diagnostic antituberculosis therapy was employed after biopsy result showed multifocal granulomatous inflammation. The therapy reduced the lymph nodes, but the condition repeated, and the whole body pain appeared. Further examinations showed that lung cancer in the right upper lobe was accompanied by obstructive pneumonia and whole body metastasis to multiple sites. The patient had no history of immunosuppression, and the γ interferon antibody was strongly positive, adult-onset immunodeficiency syndrome was considered. In order to confirm the diagnosis, bone and tissue biopsy were necessary, but the patient failed to cooperate. The histopathological examination results of the right cervical lymph node and the left iliac bone biopsy were weakly acid fast staining positive, Nocardia infection was suspected. The clinical symptoms improved after using sulfanilamide and imipenem empirical treatments against Nocardia. The content of cyanobacteria marneffei, which was detected by metagenomic next generation sequencing, was low. More laboratory pathogenic examinations were actively confirmed for this rare pathogen. The antifungal treatment (amphotericin B plus itraconazole) was used after successfully cultivating the cyanobacteria marneffei pathogen. After two months, the body nodules and masses disappeared and the skin wounds healed. It is of great significance to the diagnosis and treatment of patients to obtain qualified samples, maintain timely communication between the laboratory and the clinic, and construct reasonable interpretations of the results of metagenomic next generation sequencing technology.
ABSTRACT
Objective:To study the characteristics and evolution of the whole genome sequence of an imported Chikungunya virus (CHIKV) case in Tianjin, China, and to provide a scientific basis for the surveillance and control of CHIKV.Methods:The serum specimen of CHIKV was collected at Tianjin Second People's Hospital, on November 4th, 2019, and the viral RNA was extracted. Eleven overlapping primers were used to amplify the complete genome of CHIKV by RT-PCR. The amplification products were then subjected to next generation sequencing (NGS) using Illumina Miniseq platform.Results:The complete genome sequence of the Tianjin CHIKV obtained had similarities ranging from 92.72% to 99.86% with other Chinese isolates. Phylogenetic analysis indicated that the Tianjin CHIKV belonged to the Indian Ocean Lineage (IOL), East/Central/South African (ECSA) cluster, consistent with most strains from China. The Tianjin CHIKV is most similar (99.74%) to a Pakistan strain. Compared with the reference strain S27, 37 non-structural and 28 structural protein amino acid substitutions had been detected in Tianjin CHIKV genome, including two key site mutations, E1-D284E and E2-I211T, in accordance with other strains in the ECSA cluster. Besides, Tianjin CHIKV possessed two point virulent residues at position 12 and 82 in E2, and also a nsP3-R524Opal nonsense mutation.Conclusions:Tianjin CHIKV showed stronger virulence and greater transmissibility in Aedes albopictus. Therefore, the surveillance and monitoring of CHIKV in China should be strengthened.
ABSTRACT
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
ABSTRACT
Objective:To analyze the genetic etiology of 487 fetuses with increased nuchal translucency (NT) using copy number variant sequencing (CNV-seq) and explore the relationship between increased NT and chromosomal abnormality.Methods:A retrospective study was performed on 487 fetuses with increased NT who received CNV-seq in the First Affiliated Hospital of Zhengzhou University from January 2018 to December 2020. These fetuses either had NT of ≥3.0-<3.5 mm (Group A, n=129) or ≥3.5 mm (Group B, n=358), the distribution and incidence of chromosomal abnormalities in the two sets of fetuses were analyzed using Chi square test or Fisher's exact test. Results:Fetuses with abnormal chromosomes accounted for 25.9%(126/487) of cases, including 107 with chromosome aneuploidy (22.0%) and 19 with pathogenic or likely pathogenic copy number variation (CNV, 3.9%). The detection rate of fetal aneuploidy in Group B was higher than that in Group A [14.0% (18/129) vs 24.9% (89/358), χ2=6.58, P=0.010]. However, no significant difference was observed regarding the detection rate of pathogenic or likely pathogenic CNV between the two groups ( χ2=0.30, P=0.584). Conclusions:The risk of fetal chromosome aneuploidy increased with NT thickness, but not with pathogenic or likely pathogenic CNV, which needed further verification due to the small sample size. CNV-seq is an option to detect the conventional detection methods for the genetic etiology of NT thickening fetuses.
ABSTRACT
Objective:To investigate the molecular genetic etiology of two fetuses with short rib-polydactyly syndrome type Ⅲ (SRPS Ⅲ).Methods:Next-generation sequencing (NGS) was used to detect 226 known genes related to inherited skeletal dysplasia in two fetuses with SRPS Ⅲ diagnosed in the First Affiliated Hospital of Zhengzhou University in August 2015 and June 2020. Suspect pathological variants were verified in the pedigree members using Sanger sequencing. The prenatal genetic diagnosis of the high-risk fetus in pedigree one was conducted to identify the confirmed pathogenic variation.Results:The homozygous mutation of DYNC2H1 gene c.5881A>G(p.Lys1961Glu) was identified in the proband in pedigree one, and the parents were the carriers. The proband in pedigree two carried compound heterozygous mutations in the DYNC2H1 gene with c.10606C>T(p.Arg3536*) inherited from the father and c.8954T>G(p.Val2985Gly) from the mother. Autosomal recessive inheritance was confirmed in both pedigrees. Mutations of c.5881A>G(p.Lys1961Glu) and c.8954T>G(p.Val2985Gly) in the DYNC2H1 gene were likely pathogenic variants and had not been reported before. The prenatal diagnosis did not identify the DYNC2H1 gene c.5881A>G(p.Lys1961Glu) mutation in the fetus (Ⅱ-7) in pedigree one, which was confirmed by the umbilical cord blood sample after birth. Conclusion:DYNC2H1 gene mutation underlies the fetal skeletal dysplasia in the two pedigrees.
ABSTRACT
Objective:To investigate the diagnostic value of long noncoding RNA (lncRNA) extracted from serum exosomes in epithelial ovarian cancer (EOC).Methods:(1) Patients with ovarian tumors who were hospitalized in the Affiliated Tumor Hospital of Guangxi Medical University from August 2018 to December 2019, including 35 cases of EOC patients (malignant group) and 20 cases of benign ovarian tumor patients (benign group) were collected; during the same period, 15 healthy women (normal group) who underwent physical examination in the Affiliated Tumor Hospital of Guangxi Medical University were used as controls. Fasting venous blood serum was collected from the above three groups of women, and serum exosomes were isolated and purified using commercial kits. The morphology of exosomal particles was observed with transmission electron microscope, and the particle size distribution of the exosomes was detected by NanoSight technology. The expression of specific proteins cluster of differentiation (CD) 63, CD 81, and tumor susceptibility gene 101 (TSG101) of exosomes were analyzed by western blot. (2) Four cases of EOC patients and three cases of healthy women were randomly selected. High-throughput sequencing technology was used to analyze the differentially expressed lncRNA in serum exosomes of these four EOC patients and three healthy women, and screen out the significantly differentially expressed lncRNA. The screened lncRNA with different expression levels was verified by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) in these seven original clinical samples, furtherly confirmed and tested with QRT-PCR in larger clinical samples (a total of 70 serum samples). (3) The receiver operating characteristic (ROC) curve of the target lncRNA was drawn and its diagnostic indicators such as sensitivity and specificity were evaluated. By using logistic binary regression model, multi-factor joint diagnostic models were constructed and evaluated. Results:(1) Under transmission electron microscope, clear lipid bilayer structure was observed in serum exosomes, and one side presented a concave hemispheric or cup like structure; the peak diameter of the exosomal particles detected with NanoSight technology was 127.6 nm, and the particles between 30 and 150 nm accounted for 58.9%; western blot confirmed that the obtained (exosomal) particles could detect the expression of the marker proteins CD 63, CD 81, and TSG101. (2) Analysis of high-throughput sequencing technology showed that compared with the women in the normal sequencing group (3 cases), 425 differentially expressed lncRNAs (including 23 up-regulated and 402 down-regulated) were screened in the serum exosomes of the malignant sequencing group (4 cases). Six types of lncRNA with significantly abnormal expression levels (including FER1L6-AS2, LINC00470, LINC01811, CXXC4-AS1, LINC02343, and LINC02428) were randomly selected for original sample verification, and the results were consistent with the sequencing results. Subsequently, these six lncRNAs were used for larger samples QRT-PCR verification. Compared with the benign and normal groups, the expression of FER1L6-AS2, LINC00470 and LINC01811 in malignant group increased by 1.66 and 1.84-fold, 2.05 and 2.46-fold, 2.94 and 2.35-fold, respectively; the expressions of CXXC4-AS1, LINC02343 and LINC02428 were down-regulated to 29% and 34%, 40% and 46%, 42% and 42%, respectively. For the same lncRNA, there were statistical differences between the malignant group and the benign group, between the malignant group and the normal group (all P<0.05), and there were no statistical differences between the benign group and the normal group (all P>0.05). (3) The results showed that the area under curve (AUC) of these six lncRNAs ranged from 0.722 to 0.805, which had moderate diagnostic efficiency. To use logistic binary regression model to establish multi-indicator joint diagnostic models and establish different joint factor ROC curves. The results showed that the AUC of the joint factor prediction model 1 (composed of FER1L6-AS2 and LINC01811), the joint factor prediction model 2 (composed of CXXC4-AS1, LINC02343, and LINC02428), and the joint factor prediction model 3 (composed of FER1L6-AS2, CXXC4-AS1, LINC02343, and LINC02428) were 0.865, 0.934, and 0.962, respectively. The diagnostic efficacy of the combined factor prediction models was higher than that of the single lncRNA (all P<0.05). Conclusions:High-throughput sequencing technology is an effective method for screening out the different expression levels of lncRNA extracted from serum exosomes. The combined detection of multiple serum exosomal lncRNA indicators has a certain diagnostic efficacy for patients with EOC. Detection of serum exosomal lncRNA indicators will provide new ideas for the diagnosis of EOC.
ABSTRACT
Objective:To explore the application value of next-generation sequencing (mNGS) technology in patients with Herpes simplex pneumonia mixed infection.Methods:The clinical data of pneumonia patients who underwent alveolar lavage fluid mNGS technology and traditional pathogen detection in the Affiliated Hospital of Yangzhou University from June 2018 to January 2021 were retrospectively collected.Results:A total of 41 patients with mNGS Herpes simplex type 1 (HSV-1) test (4 HSV-1 carriers, 37 HSV-1 infections) were enrolled in this study, including 22 males and 19 females. The age ranged from 46 to 83 years old, with a median age of 67 years. The higher proportion of pathogens in 25 cases of HSV-1 co-infection detected by mNGS were Pneumocystis jiroveci (6 cases, 24.0%), Acinetobacter baumannii (4 cases, 16.0%), and Klebsiella pneumoniae (4 cases, 16.0%), and Aspergillus fumigatus (3 cases, 12.0%). The difference in the Simpson's diversity index in the HSV-1carrier group, HSV-1 single infection group and HSV-1 mixed infection group was statistically significant ( P<0.05). Compared with 12 cases of HSV-1 single infection, the time for body temperature to return to normal for 25 cases of HSV-1 mixed infection was [(5.16±2.04)days vs (3.75±1.29)days], and course of antibiotic treatment was longer [(10.60±2.18)d vs (8.92±1.98)d]. Conclusions:The mNGS technology has obvious advantages in identifying HSV-1 mixed infections, which is beneficial to physicians to treat them accurately.
ABSTRACT
Objective:To observe the results of 16S rDNA high-throughput sequencing analysis of intestinal flora in patients with depression before and after antidepressant treatment.Methods:94 patients with major depression treated in the First Hospital of Shanxi Medical University from January 2020 to December 2020 were selected as the research objects. All patients were treated with paroxetine hydrochloride for 12 weeks. Fecal samples were collected before and after treatment. The patients were divided into effective group and ineffective group according to the treatment effect. 16S rDNA high-throughput sequencing was used to detect the changes of flora before and after treatment.Results:There was significant difference in age and gender between the two groups (all P<0.05). There was no significant difference in α diversity index such as Chao1, PD and Shannon index between effective group and ineffective group before and after treatment (all P>0.05). β diversity analysis showed that there was a graphical difference between the effective group and the ineffective group at baseline, but it did not show statistical significance after adjusting for age and gender (Adonis, P=0.078). Compared with the ineffective group, the effective group had fecal bacilli enrichment at baseline. β-diversity analysis showed that there was no clear pattern of microbiota changes in the effective group ( P=0.142) and ineffective group ( P=0.127) from baseline to post-treatment. After treatment, the abundance of Roche bacteria in the effective group increased significantly ( P=0.013, Cohen′s d=1.90), while the abundance of Flavonifractor decreased significantly ( P=0.01, Cohen′s=5.84). Before and after treatment, the samples of the ineffective group did not identify the genus with diversity through DESeq2. The logarithm ratio of the top ranked genera (top 12%) to the bottom ranked genera (bottom 12%) in the ineffective group increased significantly ( P=0.027, Cohen′s=1.1). Conclusions:The baseline fecal microbiota status may have an impact on the treatment outcome of depression, and improving the intestinal microbiota status may contribute to the remission of depression.
ABSTRACT
Objective:To explore the application value of low depth and high-throughput gene sequencing in detecting chromosome copy number variations (CNVs) in different risk indicators of prenatal diagnosis.Methods:We retrospectively analyzed the genetic testing results of 1 597 pregnant women who underwent amniocentesis in Maternal and Child Health Care of Zaozhuang from January 2017 to December 2020 to obtain amniotic fluid cells and undergo high-throughput gene sequencing for chromosome copy number variation (CNV-seq). The CNV-seq results was compared with G-banding karyotype analysis.Results:The success rate of CNV-seq detection in 1 597 cases of amniotic fluid cells was 100%, and 301 cases of chromosomal CNVs were found, with an abnormal rate of 18.85%. Among them, 208 cases of chromosomal CNVs with definite pathogenicity accounted for 69.10%; There were 93 cases of CNVs with unknown pathogenicity, accounting for 30.90%. Among 208 cases of CNVs with definite pathogenicity, 166 cases had abnormal chromosome aneuploidy, accounting for 79.81%; 42 cases of chromosomal deletion / duplication structural abnormality, accounting for 20.19%. The detection of chromosomal copy number abnormalities in different prenatal diagnosis indicators was different. The incidence of chromosomal CNVs in the NIPT screening risk group was the highest (53.09%, 163/307), followed by the ultrasonic structural abnormality group (22.38%, 32/143), the chromosomal abnormality carrying group (12.50%, 5/40), the other abnormality group (11.34%, 22/194), the serological prenatal screening high-risk group (9.04%, 74/819), and the elderly group (5.32%, 5/94). Compared with G-banding karyotype analysis, CNV-seq has a detection rate of 100% for 166 cases of chromosomal aneuploidy and 13 cases of unbalanced chromosomal structural abnormalities confirmed by G-banding karyotype analysis. In addition, and more pathogenicity specific chromosomal microdeletions / microduplication abnormalities can be found by CNV-seq.Conclusions:CNV-seq has high success rate and short time-consuming in the detection of chromosome CNVs, which can effectively avoid the failure of karyotype analysis and the problem of time-consuming; Moreover, CNV-seq can also find additional CNVs with clear pathogenicity, improve the positive detection rate, and effectively prevent the birth of defective children. Therefore, pregnant women with different prenatal diagnosis indications should be tested with CNV-seq at the same time of amniotic fluid karyotype analysis. CNV-seq can be used as a first-line auxiliary diagnostic technology in prenatal diagnosis for clinical application.
ABSTRACT
Objective:To explore the value of Neoseq in screening and diagnosis of neonatal fatty acid oxidation disorders (FAOD).Methods:A retrospective case-control study was conducted on 163 500 live births in Changzhou city from April 2015 to April 2021. The following two models were adopted for FAOD screening and diagnosis. (1) Traditional mode: Heel blood samples were obtained from all subjects for initial screening using tandem mass spectrum (TMS), followed by next-generation sequencing (NGS) and other differential diagnostic testings for those with positive results. (2) Neoseq: Neoseq was performed on the true positive, negative and false positive cases according to the traditional mode screening results. The detection rate, additional discovery, reporting period, and other parameters of the two models for FAOD were described and compared.Results:(1) Detection and diagnosis of FAOD: A total of 18 confirmed cases of FAOD were detected through the traditional model, with an incidence of 1/9 083 in Changzhou city. The positive rate was 0.55% (907/163 500) for initial TMS and 0.04% (73/163 500) for the second. The positive predictive value was 2.0%(18/907), with a false positive rate of 98%(889/907) in the initial screening. (2) The results of Neoseq: ①Pathogenic mutations were detected in 16 of the 18 confirmed cases, and the coincidence rate of mutation sites between the two methods was 16/18. The other two confirmed cases were missed diagnosed by Neoseq, including one β-ketothiolase deficiency with only one detected pathogenic mutation and one medium-chain acyl-CoA dehydrogenase deficiency without any detected pathogenic mutation. ②No pathogenic mutations were detected in the 57 false-positive cases by Neoseq. ③Among the 100 negative cases in initial screening, DUOX2 heterozygous mutation, and MTTL1 hemizygous mutation were detected in one case each. ④The median period of results reporting was 43.5 d (28-104 d) for the traditional mode and 12 d (10-15 d) for the Neoseq mode. Conclusions:Neoseq has a high detection rate for FAOD. Combined with TMS screening, Neoseq reduces the false-positive rate of biochemical screening, rapidly identifies genetic causes by shortening the results waiting time and covers diseases that couldn't be detected by traditional biochemical methods.
ABSTRACT
Objective:To investigate the application value of Metagenomic Next-Generation sequencing (mNGS) in infectious patients after allogeneic hematopoietic stem cell transplantation(allo-HSCT).Methods:Patients suspected with local or systemic infections were retrospectively included after allo-HSCT in our department from April 2019 to November 2020. Pathogenic microorganisms were tested by mNGS in samples from peripheral blood, cerebrospinal fluid, alveolar lavage Liquid, abscess, etc. Other diagnostic methods such as bacterial/fungal culture, viral PCR detection were simultaneously explored comparing with mNGS results.Results:A total of 112 samples in 83 patients were detected by mNGS, and 34 pathogenic microorganisms were determined. Among these positive samples, 11 strains of bacteria (17 times) with the most common Escherichia coli (4/17) were reported. There were 7 strains of fungi (10 times) detected with primary Candida albicans (7/29). Although arvovirus 30.2% (39/129) were predominantly detected, its diagnostic relevance with infections was not definite. Other pathogenic viruses including cytomegalovirus (CMV) 25.6% (33/129) and Epstein Barr virus (EBV) 14.0% (18/129)were of significance. Comparing with golden diagnostic criteria, the sensitivity of mNGS was 86.5%, and specificity was 45.0%. Regarding single pathogen infection, the consistency of mNGS and conventional methods was 82.9% (29/35), while it was 16/17 in combination infections.Conclusion:mNGS could be a potential method to determine pathogens in patients suspected with infections after allo-HSCT.